Yeast dsRNA viral transcriptase pause products: Identification of the transcript strand

Victoria E. Brennan; Libuse A. Bobek; Jeremy A. Bruenn

doi:10.1093/nar/9.19.5049

Yeast dsRNA viral transcriptase pause products: Identification of the transcript strand

Victoria E. Brennan
, Libuse A. Bobek
, Jeremy A. Bruenn

Biological Sciences

SUNY Buffalo

Research output: Contribution to journal › Article › peer-review

12 Scopus citations

Abstract

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3′ terminus of L is the initiation site of transcription and that a number of pause products are made. One prominant product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACU_OH.

Original language	English
Pages (from-to)	5049-5060
Number of pages	12
Journal	Nucleic Acids Research
Volume	9
Issue number	19
DOIs	https://doi.org/10.1093/nar/9.19.5049
State	Published - Oct 10 1981

Access to Document

10.1093/nar/9.19.5049

Cite this

@article{6950897f7a8f43009f41fd11d03be69c,

title = "Yeast dsRNA viral transcriptase pause products: Identification of the transcript strand",

abstract = "ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3′ terminus of L is the initiation site of transcription and that a number of pause products are made. One prominant product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.",

author = "Brennan, \{Victoria E.\} and Bobek, \{Libuse A.\} and Bruenn, \{Jeremy A.\}",

year = "1981",

month = oct,

day = "10",

doi = "10.1093/nar/9.19.5049",

language = "English",

volume = "9",

pages = "5049--5060",

journal = "Nucleic Acids Research",

issn = "0305-1048",

publisher = "Oxford University Press",

number = "19",

}

TY - JOUR

T1 - Yeast dsRNA viral transcriptase pause products

T2 - Identification of the transcript strand

AU - Brennan, Victoria E.

AU - Bobek, Libuse A.

AU - Bruenn, Jeremy A.

PY - 1981/10/10

Y1 - 1981/10/10

N2 - ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3′ terminus of L is the initiation site of transcription and that a number of pause products are made. One prominant product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

AB - ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3′ terminus of L is the initiation site of transcription and that a number of pause products are made. One prominant product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

UR - https://www.scopus.com/pages/publications/0019732024

U2 - 10.1093/nar/9.19.5049

DO - 10.1093/nar/9.19.5049

M3 - Article

C2 - 7031603

AN - SCOPUS:0019732024

SN - 0305-1048

VL - 9

SP - 5049

EP - 5060

JO - Nucleic Acids Research

JF - Nucleic Acids Research

IS - 19

ER -

Yeast dsRNA viral transcriptase pause products: Identification of the transcript strand

Abstract

Access to Document

Other files and links

Fingerprint

Cite this