Abstract
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGT ACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.
| Original language | English |
|---|---|
| Pages (from-to) | 639-642 |
| Number of pages | 4 |
| Journal | Journal of Virology |
| Volume | 54 |
| Issue number | 2 |
| DOIs | |
| State | Published - 1985 |
Fingerprint
Dive into the research topics of 'Fine mapping and sequencing of a variable segment in the inverted repeat region of Varicella-Zoster virus DNA'. Together they form a unique fingerprint.Cite this
- APA
- Author
- BIBTEX
- Harvard
- Standard
- RIS
- Vancouver